Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05607

HP ID(1) HP05607
Gene ID(2) 388962
Gene Symbol finder BOLA3
Protein Name bolA homolog 3 (E. coli)
RefSeq NM_212552.2
Length of RefSeq (bp) 554
Chromosome 2p13.1
Reference DDBJ accession
UniGene Hs.61472

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe60G09 pKA1U5 GATACAGTGACCTCGGGCGGCGGGTCACGTCGGCCGGGCATGGCTGCATGGAGCCCGGCC
ARi06D06 pGCAP10 GGTCGGCCGGGCATGGCTGCATGGAGCCCGGCCGCGGCAGCGCCTCTCCTCCGCGGGATC
RBd98F10 pGCAP10 GGGCGGGTCACGTCGGCCGGGCATGGCTGCATGGAGCCCGGCCGCGGCAGCGCCTCTCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl