Prev. | 

RIKEN DNA Bank Human Resource - BOLA3

Gene ID NCBI Gene 388962 |  KEGG hsa:388962
Gene Symbol BOLA3
Protein Name bolA family member 3
Synonyms MMDS2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010843 IRAK027B19 pCMV-SPORT6 BC017744 NM_001035505 Partial
HGX025754 IRAK064G10 pCMV-SPORT6 BC028282 NM_001035505 Partial/var
HGY036210 IRAK090I18 pBluescript BC042036 NM_212552 Full/var
HGY036783 IRAK091P23 pBluescript BC046531 NM_212552 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064153 ARe60G09 pKA1U5 NM_212552.2  
GATACAGTGACCTCGGGCGGCGGGTCACGTCGGCCGGGCATGGCTGCATGGAGCCCGGCC
HKR162478 ARi06D06 pGCAP10 NM_212552.2  
GGTCGGCCGGGCATGGCTGCATGGAGCCCGGCCGCGGCAGCGCCTCTCCTCCGCGGGATC
HKR399330 RBd98F10 pGCAP10 NM_212552.2  
GGGCGGGTCACGTCGGCCGGGCATGGCTGCATGGAGCCCGGCCGCGGCAGCGCCTCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl