Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05598

HP ID(1) HP05598
Gene ID(2) 7737
Gene Symbol finder RNF113A
Protein Name ring finger protein 113A
RefSeq NM_006978.2
Length of RefSeq (bp) 1312
Chromosome Xq25-q26
Reference DDBJ accession
UniGene Hs.458365

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe59E02 pKA1U5 GAGTCCTCTTCCGTCAGTGTCTTTTGCTTCGACTCCCGGCGGAGCGCGCAACGTGGAGTG
RBb56E10 pGCAP1 GTTGGGAATCTGCTAGGGCACAAGAGAGACGGGCGCTCGCGCTCTCGCAGTCCTCTTCCG
RBd75C04 pGCAP10 GGTCCTCTTCCGTCAGTGTTTTTTGCTTGTACTCCCGGCGGTCCGCGCAACGTGTTCTGT
RBdS014G04 pGCAP10 GGCAGTCCTCTTCCGTCAGTGTCTTTTGCTTCGACTCCCGGCGGAGCGCGCAACGTGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl