Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05596

HP ID(1) HP05596
Gene ID(2) 30851
Gene Symbol finder TAX1BP3
Protein Name Tax1 (human T-cell leukemia virus type I) binding protein 3
RefSeq NM_014604.2
Length of RefSeq (bp) 1421
Chromosome 17p13
Reference DDBJ accession
UniGene Hs.12956

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe59D02 pKA1U5 GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT
ARe75E07 pKA1U5 GCTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGNCGANCAGAGCAGGGTCGAGATGTCCTA
ARe85G10 pKA1U5 GGGGCGGGCCGAGCGGGGCGGCCTTTGTTAAGCAGCGAGGGCGCGACCGCGGGTACTCTG
ARe95B09 pKA1U5 GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT
ARi17F06 pGCAP10 GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT
ARiS023N02 pGCAP10 GACTCTGCTGCCGGCTTCTCGGANCGGCGCTGGGCGACCANANNNGGGTCNANATGTCCT
ARiS049N14 pGCAP10 GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT
ARiS194O02 pGCAP10 GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl