Prev. | 

RIKEN DNA Bank Human Resource - TAX1BP3

Gene ID NCBI Gene 30851 |  KEGG hsa:30851
Gene Symbol TAX1BP3
Protein Name Tax1 binding protein 3
Synonyms TIP-1|TIP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031699 IRAK079E03 pCMV-SPORT6 BC035653 NM_014604 Partial
HGY093148 IRAL032O12 pDNR-LIB BC023980 NM_014604 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE020954 W01A052G10 pENTR-TOPO IRAL032O12 BC023980 NM_014604  
HGE020960 W01A052G16 pENTR-TOPO IRAL032O12 BC023980 NM_014604  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063674 ARe59D02 pKA1U5 NM_014604.2  
GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT
HKR070103 ARe75E07 pKA1U5 NM_014604.2  
GCTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGNCGANCAGAGCAGGGTCGAGATGTCCTA
HKR074154 ARe85G10 pKA1U5 NM_014604.2  
GGGGCGGGCCGAGCGGGGCGGCCTTTGTTAAGCAGCGAGGGCGCGACCGCGGGTACTCTG
HKR078033 ARe95B09 pKA1U5 NM_014604.2  
GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT
HKR166926 ARi17F06 pGCAP10 NM_014604.2  
GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT
HKR209514 ARiS023N02 pGCAP10 NM_014604.2  
GACTCTGCTGCCGGCTTCTCGGANCGGCGCTGGGCGACCANANNNGGGTCNANATGTCCT
HKR219926 ARiS049N14 pGCAP10 NM_014604.2  
GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT
HKR277938 ARiS194O02 pGCAP10 NM_014604.2  
GACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl