Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05595

HP ID(1) HP05595
Gene ID(2) 5533
Gene Symbol finder PPP3CC
Protein Name protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)
RefSeq NM_005605.3
Length of RefSeq (bp) 2221
Chromosome 8p21.3
Reference DDBJ accession
UniGene Hs.655661

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe59C07 pKA1U5 GGGCCCGGGCCGCGAGCAGCCGCGGCCGATCCCGGTTCGCCACCCTTAGCAGCGGTCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl