DNA Bank Top |  KEGG KO K04348 > 

RIKEN DNA Bank Human Resource - PPP3CC

Gene ID NCBI Gene 5533 |  KEGG hsa:5533
Gene Symbol PPP3CC
Protein Name protein phosphatase 3 catalytic subunit gamma
Synonyms CALNA3|CNA3|PP2Bgamma
Featured content Wnt signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Axon guidance - human
Featured content Alzheimer disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human

Link

Ortholog resource in our bank

  PPP3CC

External database

human PPP3CC

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19408 pCAG-hPPP3CC-FLAG Expression vector of human PPP3CC with FLAG-tag.    
RDB05331 pAxCALNLhPPP3CC(forward) Shuttle vector to generate rAd expressing human PPP3CC    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085745 IRAL014G01 pOTB7 BC004864 NM_005605

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007522 W01A018N10 pENTR-TOPO IRAL014G01 BC004864 NM_005605  
HGE007526 W01A018N14 pENTR-TOPO IRAL014G01 BC004864 NM_005605  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063655 ARe59C07 pKA1U5 NM_005605.3  
GGGCCCGGGCCGCGAGCAGCCGCGGCCGATCCCGGTTCGCCACCCTTAGCAGCGGTCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl