Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05594

HP ID(1) HP05594
Gene ID(2) 7372
Gene Symbol finder UMPS
Protein Name uridine monophosphate synthetase (orotate phosphoribosyl transferase and orotidine-5'-decarboxylase)
RefSeq NM_000373.2
Length of RefSeq (bp) 2658
Chromosome 3q13
Reference DDBJ accession
UniGene Hs.2057

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe59C05 pKA1U5 ATCCTGGAAACAGGCAGCGCGCGACAATGGCGGTCGCTCGTGCAGCTTTGGGGCCATTGG
ARe83B01 pKA1U5 GGAAGCAAACAGGCAGCGCGCGACAATGGCGGTCGCTCGTGCAGCTTTGGGGCCATTGGT
RBb49H09 pGCAP1 GGCCTGGGAGTTTGAAGCAAACAGGCAGCGCGCGACAATGGCGGTCGCTCGTGCAGCTTT
RBd01H11 pGCAP10 GGCCTGGGAGTTTGAAGCAAACAGGCAGCGCGCGACAATGGCGGTCGCTCGTGCAGCTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl