Prev. |  KEGG KO K13421 > 

RIKEN DNA Bank Human Resource - UMPS

Gene ID NCBI Gene 7372 |  KEGG hsa:7372
Gene Symbol UMPS
Protein Name uridine monophosphate synthetase
Synonyms OPRT
Ortholog resources KEGG ortholog (KEGG orthology K13421) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080759 IRAL001O23 pOTB7 BC000364 NM_000373 Full
HGY084377 IRAL010P17 pOTB7 BC007511 NM_000373 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063653 ARe59C05 pKA1U5 NM_000373.2  
ATCCTGGAAACAGGCAGCGCGCGACAATGGCGGTCGCTCGTGCAGCTTTGGGGCCATTGG
HKR073225 ARe83B01 pKA1U5 NM_000373.2  
GGAAGCAAACAGGCAGCGCGCGACAATGGCGGTCGCTCGTGCAGCTTTGGGGCCATTGGT
HKR339777 RBb49H09 pGCAP1 NM_000373.2  
GGCCTGGGAGTTTGAAGCAAACAGGCAGCGCGCGACAATGGCGGTCGCTCGTGCAGCTTT
HKR360579 RBd01H11 pGCAP10 NM_000373.2  
GGCCTGGGAGTTTGAAGCAAACAGGCAGCGCGCGACAATGGCGGTCGCTCGTGCAGCTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl