Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05593

HP ID(1) HP05593
Gene ID(2) 5007
Gene Symbol finder OSBP
Protein Name oxysterol binding protein
RefSeq NM_002556.2
Length of RefSeq (bp) 5083
Chromosome 11q12-q13
Reference DDBJ accession
UniGene Hs.597091

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe59A03 pKA1U5 GGGGGACGCTGCGCGGCGGTGGCTGATGCGGTANCCGTGATGGGGCGCTCCGGGCGGCGA
ARi42D11 pGCAP10 GGGCGGTGGCTGATGCGGTAGCCGTGTGGGGCGCTCCGGGCGGCGACGGCGGCTCTCGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl