Prev. |  KEGG KO K20456 > 

RIKEN DNA Bank Human Resource - OSBP

Gene ID NCBI Gene 5007 |  KEGG hsa:5007
Gene Symbol OSBP
Protein Name oxysterol binding protein
Synonyms OSBP1
Ortholog resource in our bank

  OSBP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY099106 IRAL047M18 pOTB7 BC051350 NM_002556 Partial/var
HGY100567 IRAL051G23 pDNR-LIB BC063121 NM_002556 Partial/var
HGY094738 IRAL036O02 pDNR-LIB BC017975 NM_002556

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2021Apr07.csv
GNP_full_IRAL_2021Apr13.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113636 M01C084B12 pDONR221 IMS05-H06 BC011581 NM_002556  
HGE113684 M01C084D12 pDONR221 IMS05-H06 BC011581 NM_002556  
HGE113732 M01C084F12 pDONR221 IMS05-H06 BC011581 NM_002556  
HGE113780 M01C084H12 pDONR221 IMS05-H06 BC011581 NM_002556  
HGE113828 M01C084J12 pDONR221 IMS05-H06 BC011581 NM_002556  
HGE113876 M01C084L12 pDONR221 IMS05-H06 BC011581 NM_002556  
HGE113924 M01C084N12 pDONR221 IMS05-H06 BC011581 NM_002556  
HGE113972 M01C084P12 pDONR221 IMS05-H06 BC011581 NM_002556  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063603 ARe59A03 pKA1U5 NM_002556.2 done
GGGGGACGCTGCGCGGCGGTGGCTGATGCGGTANCCGTGATGGGGCGCTCCGGGCGGCGA
HKR176883 ARi42D11 pGCAP10 NM_002556.2 done
GGGCGGTGGCTGATGCGGTAGCCGTGTGGGGCGCTCCGGGCGGCGACGGCGGCTCTCGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl