Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05572

HP ID(1) HP05572
Gene ID(2) 201294
Gene Symbol finder UNC13D
Protein Name unc-13 homolog D (C. elegans)
RefSeq NM_199242.2
Length of RefSeq (bp) 4406
Chromosome 17q25.1
Reference DDBJ accession
UniGene Hs.41045

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe56F06 pKA1U5 GGTAGGGATCCCANCTGGGGAAGGTGCAGGGGNCCTTNNAAAGACTGCCTCTCCGAAGCG
ARi54A01 pGCAP10 GAGGGGGCCTGGGAGACTGCCTCTCCGAAGCGGTGAAACCCTCACCCTTCCGTCCCTCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl