Prev. |  KEGG KO K19728 > 

RIKEN DNA Bank Human Resource - UNC13D

Gene ID NCBI Gene 201294 |  KEGG hsa:201294
Gene Symbol UNC13D
Protein Name unc-13 homolog D
Synonyms FHL3|HLH3|HPLH3|Munc13-4
Ortholog resource in our bank

  UNC13D

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY100249 IRAL050K09 pOTB7 BC067084 NM_199242 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080839 M01C002B15 pDONR221 04-134-2_1-G08 BC067084 NM_199242  
HGE080887 M01C002D15 pDONR221 04-134-2_1-G08 BC067084 NM_199242  
HGE080935 M01C002F15 pDONR221 04-134-2_1-G08 BC067084 NM_199242  
HGE080983 M01C002H15 pDONR221 04-134-2_1-G08 BC067084 NM_199242  
HGE081031 M01C002J15 pDONR221 04-134-2_1-G08 BC067084 NM_199242  
HGE081079 M01C002L15 pDONR221 04-134-2_1-G08 BC067084 NM_199242  
HGE081127 M01C002N15 pDONR221 04-134-2_1-G08 BC067084 NM_199242  
HGE081175 M01C002P15 pDONR221 04-134-2_1-G08 BC067084 NM_199242  
HGE094802 M01C037A02 pDONR221 MGC08-B01 BC067084 NM_199242  
HGE094850 M01C037C02 pDONR221 MGC08-B01 BC067084 NM_199242  
HGE094898 M01C037E02 pDONR221 MGC08-B01 BC067084 NM_199242  
HGE094946 M01C037G02 pDONR221 MGC08-B01 BC067084 NM_199242  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062526 ARe56F06 pKA1U5 NM_199242.2  
GGTAGGGATCCCANCTGGGGAAGGTGCAGGGGNCCTTNNAAAGACTGCCTCTCCGAAGCG
HKR181601 ARi54A01 pGCAP10 NM_199242.2  
GAGGGGGCCTGGGAGACTGCCTCTCCGAAGCGGTGAAACCCTCACCCTTCCGTCCCTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl