Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05557

HP ID(1) HP05557
Gene ID(2) 79096
Gene Symbol finder C11orf49
Protein Name chromosome 11 open reading frame 49
RefSeq NM_024113.3
Length of RefSeq (bp) 1735
Chromosome 11p11.2
Reference DDBJ accession
UniGene Hs.368296

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe55B01 pKA1U5 GGGAAGCCGGAGAGCTGGAGCTTTGAAGCCACCCCGGNTCAAAGGATGCTGAGTCCGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl