Prev. | 

RIKEN DNA Bank Human Resource - C11orf49

Gene ID NCBI Gene 79096 |  KEGG hsa:79096
Gene Symbol C11orf49
Protein Name chromosome 11 open reading frame 49
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084498 IRAL011E02 pOTB7 BC001860 NM_024113 Full
HGY089438 IRAL023J22 pOTB7 BC009455 NM_001003676 Full
HGY091247 IRAL028B23 pOTB7 BC013988 NM_001003677 Full
HGY098938 IRAL047F18 pOTB7 BC052291 NM_001003676 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062025 ARe55B01 pKA1U5 NM_024113.3  
GGGAAGCCGGAGAGCTGGAGCTTTGAAGCCACCCCGGNTCAAAGGATGCTGAGTCCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl