Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05554

HP ID(1) HP05554
Gene ID(2) 8936
Gene Symbol finder WASF1
Protein Name WAS protein family, member 1
RefSeq NM_003931.2
Length of RefSeq (bp) 3230
Chromosome 6q21-q22
Reference DDBJ accession
UniGene Hs.75850

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe54F12 pKA1U5 GCTGGGGCGGGGGGCAAGGATGGGACCATAGGCGGAAAGAGTCTCGCGGTCCCCCCTGCT
ARiS055E06 pGCAP10 GGGGGGGAACGGCAGCTCGCGGTGTTGTTCACTCGCGCGTCGAGCACACGGTGGGTCCGG
RBdS051E05 pGCAP10 GAGCTCGCGGTGTTGTTCACTCGCGCGTCGAGCACACGGTGGGTCCGGCGGCGTGTTGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl