Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051E05

Clone ID RBdS051E05
HP ID HP05554
Gene ID 8936
Gene Symbol WASF1
Protein Name WAS protein family, member 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003931.2
Length of RefSeq (bp) 3230
Chromosome 6q21-q22
Reference DDBJ accession
UniGene Hs.75850
5'-terminal sequence GAGCTCGCGGTGTTGTTCACTCGCGCGTCGAGCACACGGTGGGTCCGGCGGCGTGTTGGC
2011.08.28