Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05543

HP ID(1) HP05543
Gene ID(2) 83882
Gene Symbol finder TSPAN10
Protein Name tetraspanin 10
RefSeq NM_031945.3
Length of RefSeq (bp) 1613
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.208219

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe53H11 pKA1U5 AB593081 GCCCCGCCATCCCTGCAACTGGAGGAGGGGATTTTGGAAAGTTGCGTCTGAGATTACTTC
ARe88G02 pKA1U5 GAGCCCAGGGCCGCAGTCAGGACCAGCCCAGCAGCCCAGCCACAGAGGAGCCAGCGAACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl