Prev. |  KEGG KO K17351 > 

RIKEN DNA Bank Human Resource - TSPAN10

Gene ID NCBI Gene 83882 |  KEGG hsa:83882
Gene Symbol TSPAN10
Protein Name tetraspanin 10
Synonyms OCSP
Ortholog resource in our bank

  TSPAN10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027494 IRAK068M06 pCMV-SPORT6 BC032802 NM_031945 Full
HGY096334 IRAL040N22 pOTB7 BC021923 NM_031945 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037755 W01A094G11 pENTR-TOPO IRAK068M06 BC032802 NM_031945  
HGE037759 W01A094G15 pENTR-TOPO IRAK068M06 BC032802 NM_031945  
HGE037761 W01A094G17 pENTR-TOPO IRAK068M06 BC032802 NM_031945  
HGE037763 W01A094G19 pENTR-TOPO IRAK068M06 BC032802 NM_031945  
HGE037767 W01A094G23 pENTR-TOPO IRAK068M06 BC032802 NM_031945  
HGE037795 W01A094I03 pENTR-TOPO IRAK068M06 BC032802 NM_031945  
HGE046522 W01A116F02 pENTR-TOPO IRAK068M06 BC032802 NM_031945  
HGE046524 W01A116F04 pENTR-TOPO IRAK068M06 BC032802 NM_031945  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075346 ARe88G02 pKA1U5 NM_031945.5 full/var  
GAGCCCAGGGCCGCAGTCAGGACCAGCCCAGCAGCCCAGCCACAGAGGAGCCAGCGAACC
HKR061379 ARe53H11 pKA1U5 XM_024350653.2 full/var  
GCCCCGCCATCCCTGCAACTGGAGGAGGGGATTTTGGAAAGTTGCGTCTGAGATTACTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl