Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05536

HP ID(1) HP05536
Gene ID(2) 26258
Gene Symbol finder PLDN
Protein Name pallidin homolog (mouse)
RefSeq NM_012388.2
Length of RefSeq (bp) 3959
Chromosome 15q21.1
Reference DDBJ accession
UniGene Hs.719102

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe53A04 pKA1U5 TGGTTAGGTGCCGCCTTGCTTCTGACGAGCCACACGTTTGCTTCTTCCCTGTGTTCCCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl