Prev. |  KEGG KO K20188 > 

RIKEN DNA Bank Human Resource - BLOC1S6

Gene ID NCBI Gene 26258 |  KEGG hsa:26258
Gene Symbol BLOC1S6
Protein Name biogenesis of lysosomal organelles complex 1 subunit 6
Synonyms BLOS6|HPS9|PA|PALLID|PLDN
Ortholog resource in our bank

  BLOC1S6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001480 IRAK003L16 pCMV-SPORT6 BC004819 NM_012388 Full
HGY095166 IRAL037P06 pDNR-LIB BC026289 NM_012388 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061204 ARe53A04 pKA1U5 NM_012388.2  
TGGTTAGGTGCCGCCTTGCTTCTGACGAGCCACACGTTTGCTTCTTCCCTGTGTTCCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl