Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05530

HP ID(1) HP05530
Gene ID(2) 90529
Gene Symbol finder C1orf201
Protein Name chromosome 1 open reading frame 201
RefSeq NM_178122.3
Length of RefSeq (bp) 2538
Chromosome 1p36.11
Reference DDBJ accession
UniGene Hs.403187

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe51H09 pKA1U5 GGTGGGTGCCATAGCGACCGGGAGGTTGGGCTGGCCAGATTCAGCTGCCGGGACCGGACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl