Prev. | 

RIKEN DNA Bank Human Resource - STPG1

Gene ID NCBI Gene 90529 |  KEGG hsa:90529
Gene Symbol STPG1
Protein Name sperm tail PG-rich repeat containing 1
Synonyms C1orf201|MAPO2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008840 IRAK022B16 pCMV-SPORT6 BC017650 NM_178122 Partial/var
HGX039362 IRAK098G18 pCMV-SPORT6 BC047705 NM_178122 Full
HGX056782 IRAK141P22 pCMV-SPORT6.1 BC063891 NM_178122 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095211 M01C038A11 pDONR221 MGC08-E06 BC047705 NM_178122  
HGE095259 M01C038C11 pDONR221 MGC08-E06 BC047705 NM_178122  
HGE095307 M01C038E11 pDONR221 MGC08-E06 BC047705 NM_178122  
HGE095355 M01C038G11 pDONR221 MGC08-E06 BC047705 NM_178122  
HGE095403 M01C038I11 pDONR221 MGC08-E06 BC047705 NM_178122  
HGE095451 M01C038K11 pDONR221 MGC08-E06 BC047705 NM_178122  
HGE095499 M01C038M11 pDONR221 MGC08-E06 BC047705 NM_178122  
HGE095547 M01C038O11 pDONR221 MGC08-E06 BC047705 NM_178122  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060577 ARe51H09 pKA1U5 NM_178122.3  
GGTGGGTGCCATAGCGACCGGGAGGTTGGGCTGGCCAGATTCAGCTGCCGGGACCGGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl