Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05527

HP ID(1) HP05527
Gene ID(2) 9530
Gene Symbol finder BAG4
Protein Name BCL2-associated athanogene 4
RefSeq NM_004874.2
Length of RefSeq (bp) 2182
Chromosome 8p12
Reference DDBJ accession
UniGene Hs.194726

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe51F09 pKA1U5 ACGGGGGCGGGAAGCGCTTCAGGGCAGCGGATCCCATGATCGGCCCTGAGGCGCTCGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl