Prev. |  KEGG KO K09558 > 

RIKEN DNA Bank Human Resource - BAG4

Gene ID NCBI Gene 9530 |  KEGG hsa:9530
Gene Symbol BAG4
Protein Name BCL2 associated athanogene 4
Synonyms BAG-4|SODD
Ortholog resources KEGG ortholog (KEGG orthology K09558) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001941 IRAK004O05 pCMV-SPORT6 BC000800 NM_004874 Partial/var
HGY018916 IRAK047E20 pBluescriptR BC038505 NM_004874 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060529 ARe51F09 pKA1U5 NM_004874.2  
ACGGGGGCGGGAAGCGCTTCAGGGCAGCGGATCCCATGATCGGCCCTGAGGCGCTCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl