Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05523

HP ID(1) HP05523
Gene ID(2) 23532
Gene Symbol finder PRAME
Protein Name preferentially expressed antigen in melanoma
RefSeq NM_006115.3
Length of RefSeq (bp) 2148
Chromosome 22q11.22
Reference DDBJ accession
UniGene Hs.30743

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb17F06 pKA1U5 GGCGAGTTCCGGCGAGGCTTCAGGGTACAGCTCCCCCGCAGCCAGAAGCCGGGCCTGCAG
RBb53D02 pGCAP1 GGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGA
RBb57E02 pGCAP1 GATTGTCTCGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAAC
RBd04E07 pGCAP10 GGCCCCCACCGCCGCCCCCCCCGCCCCACGCAGCGGCTAGGGCGCTTAGCTGAGCCATTG
RBd38D06 pGCAP10 GAGAAAGTTCTGGGAAACCGACTCCCGGGAGCAGGGAGGAACGCGCGCTCCAGAGACAAC
RBd41D08 pGCAP10 GCTGTGCTTGATGGACTTGATGTGCTCCTTGCCCAGGAGGTTCGCCCCAGGAGGTGGAAA
RBd42B03 pGCAP10 AGCTCCCCCGCAGCCAGAAGCCGGGCCTGCAGCGCCTCAGCACCGCTCCGGGACACCCCA
RBd77C11 pGCAP10 TGATTGTCTCGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAA
RBd92A10 pGCAP10 GCGGGACACCCCACCCGCTTCCCAGGCGTGACCTGTCAACAGGTCTGTATTGGCGACAAA
RBdS007C24 pGCAP10 GATTGTCTCGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAAC
RBdS015H10 pGCAP10 GCTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGA
RBdS015J13 pGCAP10 GATTGTCTCGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAAC
RBdS040I15 pGCAP10 GGTACAGCTCCCCCGCAGCCAGAAGCCGGGCCTGCAGCGCCTCAGCACCGCTCCGGGACA
RBdS051K18 pGCAP10 GACAGCTCCCCCGCAGCCAGAAGCCGGGCCTGCAGCGCCTCAGCACCGCTCCGGGACACC
RBdS105H24 pGCAP10 GGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGA
RBdS154M20 pGCAP10 GGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl