Prev. | 

RIKEN DNA Bank Human Resource - PRAME

Gene ID NCBI Gene 23532 |  KEGG hsa:23532
Gene Symbol PRAME
Protein Name preferentially expressed antigen in melanoma
Synonyms CT130|MAPE|OIP-4|OIP4
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013454 IRAK033K14 pBluescriptR BC022008 -
HGX033038 IRAK082J22 pCMV-SPORT6 BC039731 -
HGY091390 IRAL028H22 pOTB7 BC014074 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326926 RBb17F06 pKA1U5 NM_006115.3  
GGCGAGTTCCGGCGAGGCTTCAGGGTACAGCTCCCCCGCAGCCAGAAGCCGGGCCTGCAG
HKR341274 RBb53D02 pGCAP1 NM_006115.3  
GGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGA
HKR342898 RBb57E02 pGCAP1 NM_006115.3  
GATTGTCTCGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAAC
HKR361703 RBd04E07 pGCAP10 NM_006115.3  
GGCCCCCACCGCCGCCCCCCCCGCCCCACGCAGCGGCTAGGGCGCTTAGCTGAGCCATTG
HKR375278 RBd38D06 pGCAP10 NM_006115.3  
GAGAAAGTTCTGGGAAACCGACTCCCGGGAGCAGGGAGGAACGCGCGCTCCAGAGACAAC
HKR376480 RBd41D08 pGCAP10 NM_006115.3  
GCTGTGCTTGATGGACTTGATGTGCTCCTTGCCCAGGAGGTTCGCCCCAGGAGGTGGAAA
HKR376827 RBd42B03 pGCAP10 NM_006115.3  
AGCTCCCCCGCAGCCAGAAGCCGGGCCTGCAGCGCCTCAGCACCGCTCCGGGACACCCCA
HKR390859 RBd77C11 pGCAP10 NM_006115.3  
TGATTGTCTCGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAA
HKR396810 RBd92A10 pGCAP10 NM_006115.3  
GCGGGACACCCCACCCGCTTCCCAGGCGTGACCTGTCAACAGGTCTGTATTGGCGACAAA
HKR402872 RBdS007C24 pGCAP10 NM_006115.3  
GATTGTCTCGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAAC
HKR406178 RBdS015H10 pGCAP10 NM_006115.3  
GCTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGA
HKR406229 RBdS015J13 pGCAP10 NM_006115.3  
GATTGTCTCGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAAC
HKR416207 RBdS040I15 pGCAP10 NM_006115.3  
GGTACAGCTCCCCCGCAGCCAGAAGCCGGGCCTGCAGCGCCTCAGCACCGCTCCGGGACA
HKR420658 RBdS051K18 pGCAP10 NM_006115.3  
GACAGCTCCCCCGCAGCCAGAAGCCGGGCCTGCAGCGCCTCAGCACCGCTCCGGGACACC
HKR442192 RBdS105H24 pGCAP10 NM_006115.3  
GGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGA
HKR461908 RBdS154M20 pGCAP10 NM_006115.3  
GGTTCTTTCCTCCCAGCAACTTCGCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl