Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05522

HP ID(1) HP05522
Gene ID(2) 7064
Gene Symbol finder THOP1
Protein Name thimet oligopeptidase 1
RefSeq NM_003249.3
Length of RefSeq (bp) 2568
Chromosome 19q13.3
Reference DDBJ accession
UniGene Hs.78769

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi07H06 pGCAP10 GAGGCGGCCGTGGCGGCGGTGGCGGCGGTTGGGCCGAGGCAGGCGGCCTCAGTGGCCGAG
ARi07H08 pGCAP10 GAGGCGGCCGTGGCGGCGGTGGCGGCGGTTGGGCCGAGGCAGGCGGCCTCAGTGGCCGAG
ARi18B12? pGCAP10 GGGGCGGCGGGCCCCTTGGTCCTCTGCGGCCGTGGTGGCGGTGGCGGCGGTTGGGGGAGG
RBb17F02 pKA1U5 GGTCCTCAGGCGGCCGTGGCGGCGGTGGCGGCGGTTGGGCCGAGGCAGGCGGCCTCAGTG
RBd14F11 pGCAP10 GAGGCGGCCGTGGCGGCGGTGGCGGCGGTTGGGCCGAGGCAGGCGGCCTCAGTGGCCGAG
RBdS040I24 pGCAP10 GCTCAGTGGCCGAGGTGGCTGGACGCGTAGCAGGTGGAAGGAGGGAGGGAGCCGCAGGCG
RBdS051E20 pGCAP10 GGGGAGCGCGGGCGGCGGGCCCCTTGGTCCTCAGGCGGCCGTGGCGGCGGTGGCGGCGGT
RBdS105I11 pGCAP10 TGAGCATGCCCCGGGAGCGCGGGCGGCGGGCCCCTTGGTCCTCAGGCGGCCGTGGCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl