Prev. |  KEGG KO K01392 > 

RIKEN DNA Bank Human Resource - THOP1

Gene ID NCBI Gene 7064 |  KEGG hsa:7064
Gene Symbol THOP1
Protein Name thimet oligopeptidase 1
Synonyms EP24.15|MEPD_HUMAN|MP78|TOP
Ortholog resource in our bank

  THOP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001213 IRAK003A13 pCMV-SPORT6 BC000135 NM_003249 Full
HGY080436 IRAL001B12 pOTB7 BC002391 NM_003249
HGY082347 IRAL005O11 pOTB7 BC000583 NM_003249 Partial
HGY085769 IRAL014H01 pOTB7 BC013878 NM_003249 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091621 M01C029A21 pDONR221 MGC04-A11 BC000135 NM_003249  
HGE091669 M01C029C21 pDONR221 MGC04-A11 BC000135 NM_003249  
HGE091717 M01C029E21 pDONR221 MGC04-A11 BC000135 NM_003249  
HGE091765 M01C029G21 pDONR221 MGC04-A11 BC000135 NM_003249  
HGE091813 M01C029I21 pDONR221 MGC04-A11 BC000135 NM_003249  
HGE091861 M01C029K21 pDONR221 MGC04-A11 BC000135 NM_003249  
HGE091909 M01C029M21 pDONR221 MGC04-A11 BC000135 NM_003249  
HGE091957 M01C029O21 pDONR221 MGC04-A11 BC000135 NM_003249  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162974 ARi07H06 pGCAP10 NM_003249.3  
GAGGCGGCCGTGGCGGCGGTGGCGGCGGTTGGGCCGAGGCAGGCGGCCTCAGTGGCCGAG
HKR162976 ARi07H08 pGCAP10 NM_003249.3  
GAGGCGGCCGTGGCGGCGGTGGCGGCGGTTGGGCCGAGGCAGGCGGCCTCAGTGGCCGAG
HKR167236 ARi18B12 pGCAP10 NM_003249.3  
GGGGCGGCGGGCCCCTTGGTCCTCTGCGGCCGTGGTGGCGGTGGCGGCGGTTGGGGGAGG
HKR326922 RBb17F02 pKA1U5 NM_003249.3  
GGTCCTCAGGCGGCCGTGGCGGCGGTGGCGGCGGTTGGGCCGAGGCAGGCGGCCTCAGTG
HKR365731 RBd14F11 pGCAP10 NM_003249.3  
GAGGCGGCCGTGGCGGCGGTGGCGGCGGTTGGGCCGAGGCAGGCGGCCTCAGTGGCCGAG
HKR416216 RBdS040I24 pGCAP10 NM_003249.3  
GCTCAGTGGCCGAGGTGGCTGGACGCGTAGCAGGTGGAAGGAGGGAGGGAGCCGCAGGCG
HKR420516 RBdS051E20 pGCAP10 NM_003249.3  
GGGGAGCGCGGGCGGCGGGCCCCTTGGTCCTCAGGCGGCCGTGGCGGCGGTGGCGGCGGT
HKR442203 RBdS105I11 pGCAP10 NM_003249.3  
TGAGCATGCCCCGGGAGCGCGGGCGGCGGGCCCCTTGGTCCTCAGGCGGCCGTGGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl