Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05519

HP ID(1) HP05519
Gene ID(2) 7411
Gene Symbol finder VBP1
Protein Name von Hippel-Lindau binding protein 1
RefSeq NM_003372.4
Length of RefSeq (bp) 1793
Chromosome Xq28
Reference DDBJ accession
UniGene Hs.436803

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb17D10 pKA1U5 GAGTCGCGCGCTCGCATCCCCAAGATGGCGGCCGTTAAGGACAGTTGTGGCAAAGGAGAA
RBb23D07 pGCAP1 GATCCCCAAGATGGCGGCCGTTTAAGGACAGTTTGTGGCAAAGGAGAAATGGCCACAGGG
RBb49D08 pGCAP1 GGCGCTCGCATCCCCAAGAATGGCGGCCGTTAAGGACAGTTGTGGCAAAGGAGAAATGGC
RBb70F11 pGCAP1 GGCAGTCGCGCGCTCGCATCCCCAAGATGGCGGCCGTTAAGGACAGTTGTGGCAAAGGAG
RBd09C11 pGCAP10 GAGTCGCGCGCTCGCATCCCCAAGATGGCGGCCGTTAAGGACAGTTGTGGCAAAGGAGAA
RBd17D10 pGCAP10 GAGTCGCGCGCTCGCATCCCCAAGATGGCGGCCGTTAAGGACAGTTGTGGCAAAGGAGAA
RBdS015I08 pGCAP10 GGCGCGCTCGCATCCCCAAGATGGCGGCCGTTAAGGACAGTTGTGGCAAAGGAGAAATGG
RBdS051I02 pGCAP10 GGTCGCGCGCTCGCATCCCCAAGATGGCGGCCGTTAAGGACAGTTGTGGCAAAGGAGAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl