Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05510

HP ID(1) HP05510
Gene ID(2) 4676
Gene Symbol finder NAP1L4
Protein Name nucleosome assembly protein 1-like 4
RefSeq NM_005969.3
Length of RefSeq (bp) 2564
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.501684

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS194J22 pGCAP10
RBb16H04 pKA1U5 GACTGCCGCAGGAGGCGTGAGGGGATAAAAACCTTCAGATGGCAGATCACAGTTTTTCAG
RBd16F03 pGCAP10 GGAGGCCACGGCGGCGCAGCCCCAAAGCGAGCGAAGCTAGGGTCGCCGCCACTGCCGCAG
RBdS007G21 pGCAP10 TTGGGCGCAGCCCCAAAGCGAGCGAAGCTAGGGTCGCCGCCACTGCCGCAGGAGGCGTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl