Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NAP1L4

Gene ID (NCBI) 4676
Gene Symbol NAP1L4
Protein Name nucleosome assembly protein 1-like 4
Synonyms NAP1L4b|NAP2|NAP2L|hNAP2
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03798 SEREX clone NGO-St-020 (ID 23) #1 SEREX clone NGO-St-020 (ID 23) #1

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084132 IRAL010F12 pOTB7 BC022090 NM_005969 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR277838 ARiS194J22 pGCAP10 NM_005969.3
HKR326572 RBb16H04 pKA1U5 NM_005969.3
GACTGCCGCAGGAGGCGTGAGGGGATAAAAACCTTCAGATGGCAGATCACAGTTTTTCAG
HKR366523 RBd16F03 pGCAP10 NM_005969.3
GGAGGCCACGGCGGCGCAGCCCCAAAGCGAGCGAAGCTAGGGTCGCCGCCACTGCCGCAG
HKR402965 RBdS007G21 pGCAP10 NM_005969.3
TTGGGCGCAGCCCCAAAGCGAGCGAAGCTAGGGTCGCCGCCACTGCCGCAGGAGGCGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl