Prev. |  KEGG KO K11282 > 

RIKEN DNA Bank Human Resource - NAP1L4

Gene ID NCBI Gene 4676 |  KEGG hsa:4676
Gene Symbol NAP1L4
Protein Name nucleosome assembly protein 1 like 4
Synonyms NAP1L4b|NAP2|NAP2L|hNAP2
Ortholog resource in our bank

  NAP1L4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03798 SEREX clone NGO-St-020 (ID 23) #1 SEREX clone NGO-St-020 (ID 23) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084132 IRAL010F12 pOTB7 BC022090 NM_005969 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277838 ARiS194J22 pGCAP10 NM_005969.3  
HKR326572 RBb16H04 pKA1U5 NM_005969.3  
GACTGCCGCAGGAGGCGTGAGGGGATAAAAACCTTCAGATGGCAGATCACAGTTTTTCAG
HKR366523 RBd16F03 pGCAP10 NM_005969.3  
GGAGGCCACGGCGGCGCAGCCCCAAAGCGAGCGAAGCTAGGGTCGCCGCCACTGCCGCAG
HKR402965 RBdS007G21 pGCAP10 NM_005969.3  
TTGGGCGCAGCCCCAAAGCGAGCGAAGCTAGGGTCGCCGCCACTGCCGCAGGAGGCGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl