Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05503

HP ID(1) HP05503
Gene ID(2) 339123
Gene Symbol finder JMJD8
Protein Name jumonji domain containing 8
RefSeq NM_001005920.2
Length of RefSeq (bp) 2074
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.533771

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe74E03 pKA1U5 GTTGGTGCAGCGCGGCTGCCTGAGGGCGGCAGGCTCATGGCGCCGGCGTCGCGGTTGCTC
ARf07A06 pKA1U5 GGGGCGGCAGGCTCATGGCGCCGGCGTCGCGGNTGCTCNCGCTCTGGGCGCTGGCGGCTG
RBb16D03 pKA1U5 GAGGGCGGCAGGCTCATGGCGCCGGCGTCNCGCCTTNNTCGCGCTCTGGGCGCTGGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl