Prev. | 

RIKEN DNA Bank Human Resource - JMJD8

Gene ID NCBI Gene 339123 |  KEGG hsa:339123
Gene Symbol JMJD8
Protein Name jumonji domain containing 8
Synonyms C16orf20|PP14397
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY103252 IRAL058C04 pOTB7 BC073785 NM_001005920 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069699 ARe74E03 pKA1U5 NM_001005920.2  
GTTGGTGCAGCGCGGCTGCCTGAGGGCGGCAGGCTCATGGCGCCGGCGTCGCGGTTGCTC
HKR082806 ARf07A06 pKA1U5 NM_001005920.2  
GGGGCGGCAGGCTCATGGCGCCGGCGTCGCGGNTGCTCNCGCTCTGGGCGCTGGCGGCTG
HKR326475 RBb16D03 pKA1U5 NM_001005920.2  
GAGGGCGGCAGGCTCATGGCGCCGGCGTCNCGCCTTNNTCGCGCTCTGGGCGCTGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl