Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05489

HP ID(1) HP05489
Gene ID(2) 283820
Gene Symbol finder NOMO2
Protein Name NODAL modulator 2
RefSeq NM_173614.2
Length of RefSeq (bp) 4317
Chromosome 16p12.3
Reference DDBJ accession
UniGene Hs.460141

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe49F01 pKA1U5 GAGTGTGAGGGGCGGGACCCGGCTGCCGGCGGCTGGGTCTAGCTGGGGGAGGTCGGGCCA
ARe99G02 pKA1U5 GGGTGGGTCTAGCTGGGGGAGGTCGGGCCATGCTGGTGGGCCAGGGCGCGGGGCTGCTGG
ARi41H04 pGCAP10 GAGTGTGAGGGGCGGGACCCGGCTGCCGGCGGTGGGTCTAGCTGGGGGAGGTCGGGCCAT
ARi49G09 pGCAP10 GGAAGGAGCCTGCGGCGTGCAGTGTGAGGGGCGGGACCCGGCTGCCGGCGGTGGGTCTAG
ARi56G01 pGCAP10 GGTCAGCCGGCCTAGGAGGAGGAAGGAGCCTGCGGCGTGCAGTGTGAGGGGCGGGACCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl