Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NOMO2

Gene ID (NCBI) 283820
Gene Symbol NOMO2
Protein Name NODAL modulator 2
Synonyms Nomo|PM5
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX033056 IRAK082K16 pCMV-SPORT6 BC041131 NM_173614 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR059721 ARe49F01 pKA1U5 NM_173614.2
GAGTGTGAGGGGCGGGACCCGGCTGCCGGCGGCTGGGTCTAGCTGGGGGAGGTCGGGCCA
HKR176572 ARi41H04 pGCAP10 NM_173614.2
GAGTGTGAGGGGCGGGACCCGGCTGCCGGCGGTGGGTCTAGCTGGGGGAGGTCGGGCCAT
HKR179753 ARi49G09 pGCAP10 NM_173614.2
GGAAGGAGCCTGCGGCGTGCAGTGTGAGGGGCGGGACCCGGCTGCCGGCGGTGGGTCTAG
HKR182545 ARi56G01 pGCAP10 NM_173614.2
GGTCAGCCGGCCTAGGAGGAGGAAGGAGCCTGCGGCGTGCAGTGTGAGGGGCGGGACCCG
HKR079746 ARe99G02 pKA1U5 NM_173614.2
GGGTGGGTCTAGCTGGGGGAGGTCGGGCCATGCTGGTGGGCCAGGGCGCGGGGCTGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl