Prev. | 

RIKEN DNA Bank Human Resource - NOMO2

Gene ID NCBI Gene 283820 |  KEGG hsa:283820
Gene Symbol NOMO2
Protein Name NODAL modulator 2
Synonyms Nomo|PM5
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033056 IRAK082K16 pCMV-SPORT6 BC041131 NM_173614 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059721 ARe49F01 pKA1U5 NM_173614.2  
GAGTGTGAGGGGCGGGACCCGGCTGCCGGCGGCTGGGTCTAGCTGGGGGAGGTCGGGCCA
HKR079746 ARe99G02 pKA1U5 NM_173614.2  
GGGTGGGTCTAGCTGGGGGAGGTCGGGCCATGCTGGTGGGCCAGGGCGCGGGGCTGCTGG
HKR176572 ARi41H04 pGCAP10 NM_173614.2  
GAGTGTGAGGGGCGGGACCCGGCTGCCGGCGGTGGGTCTAGCTGGGGGAGGTCGGGCCAT
HKR179753 ARi49G09 pGCAP10 NM_173614.2  
GGAAGGAGCCTGCGGCGTGCAGTGTGAGGGGCGGGACCCGGCTGCCGGCGGTGGGTCTAG
HKR182545 ARi56G01 pGCAP10 NM_173614.2  
GGTCAGCCGGCCTAGGAGGAGGAAGGAGCCTGCGGCGTGCAGTGTGAGGGGCGGGACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl