Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05472

HP ID(1) HP05472
Gene ID(2) 56006
Gene Symbol finder C19orf61
Protein Name chromosome 19 open reading frame 61
RefSeq NM_019108.2
Length of RefSeq (bp) 2371
Chromosome 19q13.31
Reference DDBJ accession
UniGene Hs.466875

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe48C12 pKA1U5 GGAGTCGCCTGAGGGAACTGATCTCAGCTCGGGCCCGCGTTACATCCTCCTCCTCTTCTT
ARe60H12 pKA1U5 GATGCGCAAGACGAGTCGCCTGAGGGAACTGATCTCAGCATCGGGCCCGCGTTACATCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl