Prev. |  KEGG KO K18735 > 

RIKEN DNA Bank Human Resource - SMG9

Gene ID NCBI Gene 56006 |  KEGG hsa:56006
Gene Symbol SMG9
Protein Name SMG9 nonsense mediated mRNA decay factor
Synonyms C19orf61|F17127_1|HBMS
Ortholog resource in our bank

  SMG9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090661 IRAL026K21 pOTB7 BC008869 NM_019108 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099231 M01C048B07 pDONR221 MGC13-G04 BC008869 ENST00000270066  
HGE099279 M01C048D07 pDONR221 MGC13-G04 BC008869 ENST00000270066  
HGE099327 M01C048F07 pDONR221 MGC13-G04 BC008869 ENST00000270066  
HGE099375 M01C048H07 pDONR221 MGC13-G04 BC008869 ENST00000270066  
HGE099423 M01C048J07 pDONR221 MGC13-G04 BC008869 ENST00000270066  
HGE099471 M01C048L07 pDONR221 MGC13-G04 BC008869 ENST00000270066  
HGE099519 M01C048N07 pDONR221 MGC13-G04 BC008869 ENST00000270066  
HGE099567 M01C048P07 pDONR221 MGC13-G04 BC008869 ENST00000270066  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059260 ARe48C12 pKA1U5 NM_019108.2  
GGAGTCGCCTGAGGGAACTGATCTCAGCTCGGGCCCGCGTTACATCCTCCTCCTCTTCTT
HKR064180 ARe60H12 pKA1U5 NM_019108.2  
GATGCGCAAGACGAGTCGCCTGAGGGAACTGATCTCAGCATCGGGCCCGCGTTACATCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl