Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05468

HP ID(1) HP05468
Gene ID(2) 283232
Gene Symbol finder TMEM80
Protein Name transmembrane protein 80
RefSeq NM_174940.2
Length of RefSeq (bp) 1613
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.448664

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe48B08 pKA1U5 GGGACCGGCGGGCGGGGCGGGTAAGATGGCGGCCCCGCGGCGAGGTGAGCTCGGGCGGGG
ARiS049K17 pGCAP10 GGGCGGGCGGGGCGGGTAAGATGGCGGCCCCGCGGCGAGGGAGAGGATCCTCCACANTGC
ARiS198D07 pGCAP10 CGGCCGGCCGATGACGGACCGGCGGGCGGGGCGGGTAAGATGGCGGCCCCGCGGCGAGGG
RBb26H01 pGCAP1 TGGGACCGGCGGGCGGGGCGGGTAAGATGGCGGCCCCGCGACGAGGGAGAGGATCCTCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl