Prev. | 

RIKEN DNA Bank Human Resource - TMEM80

Gene ID NCBI Gene 283232 |  KEGG hsa:283232
Gene Symbol TMEM80
Protein Name transmembrane protein 80
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005233 IRAK013B09 pCMV-SPORT6 BC008671 NM_174940 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059232 ARe48B08 pKA1U5 NM_174940.2  
GGGACCGGCGGGCGGGGCGGGTAAGATGGCGGCCCCGCGGCGAGGTGAGCTCGGGCGGGG
HKR219857 ARiS049K17 pGCAP10 NM_174940.2  
GGGCGGGCGGGGCGGGTAAGATGGCGGCCCCGCGGCGAGGGAGAGGATCCTCCACANTGC
HKR279279 ARiS198D07 pGCAP10 NM_174940.2  
CGGCCGGCCGATGACGGACCGGCGGGCGGGGCGGGTAAGATGGCGGCCCCGCGGCGAGGG
HKR330569 RBb26H01 pGCAP1 NM_174940.2  
TGGGACCGGCGGGCGGGGCGGGTAAGATGGCGGCCCCGCGACGAGGGAGAGGATCCTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl