Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05465

HP ID(1) HP05465
Gene ID(2) 5480
Gene Symbol finder PPIC
Protein Name peptidylprolyl isomerase C (cyclophilin C)
RefSeq NM_000943.4
Length of RefSeq (bp) 1241
Chromosome 5q23.2
Reference DDBJ accession
UniGene Hs.110364

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe48A02 pKA1U5 TGGGCGCAGGCGCAGCCGGCCGGCAGTCCCGCTCNGCTGATCCCAGAGCCTGTGTCGCGC
ARe81F09 pKA1U5 GTGAGCCGGCCGGCAGTCCCGTCAGCTGTCCCAGAGCCTGTGTCGCGCCCGTGCCGGTAG
ARe97E12 pKA1U5 GAGTCCCGTCAGCTGTCCCAGAGCCTGTGTCGCGCCCGNTGCCGGTAGCGCCCGTGCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl