Prev. |  KEGG KO K09563 > 

RIKEN DNA Bank Human Resource - PPIC

Gene ID NCBI Gene 5480 |  KEGG hsa:5480
Gene Symbol PPIC
Protein Name peptidylprolyl isomerase C
Synonyms CYPC
Ortholog resource in our bank

  PPIC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085057 IRAL012K17 pOTB7 BC002678 NM_000943 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098030 M01C045B06 pDONR221 MGC12-D03 BC002678 NM_000943  
HGE098078 M01C045D06 pDONR221 MGC12-D03 BC002678 NM_000943  
HGE098126 M01C045F06 pDONR221 MGC12-D03 BC002678 NM_000943  
HGE098174 M01C045H06 pDONR221 MGC12-D03 BC002678 NM_000943  
HGE098222 M01C045J06 pDONR221 MGC12-D03 BC002678 NM_000943  
HGE098270 M01C045L06 pDONR221 MGC12-D03 BC002678 NM_000943  
HGE098318 M01C045N06 pDONR221 MGC12-D03 BC002678 NM_000943  
HGE098366 M01C045P06 pDONR221 MGC12-D03 BC002678 NM_000943  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059202 ARe48A02 pKA1U5 NM_000943.4  
TGGGCGCAGGCGCAGCCGGCCGGCAGTCCCGCTCNGCTGATCCCAGAGCCTGTGTCGCGC
HKR072529 ARe81F09 pKA1U5 NM_000943.4  
GTGAGCCGGCCGGCAGTCCCGTCAGCTGTCCCAGAGCCTGTGTCGCGCCCGTGCCGGTAG
HKR078908 ARe97E12 pKA1U5 NM_000943.4  
GAGTCCCGTCAGCTGTCCCAGAGCCTGTGTCGCGCCCGNTGCCGGTAGCGCCCGTGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl