Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05459

HP ID(1) HP05459
Gene ID(2) 9907
Gene Symbol finder KIAA0415
Protein Name KIAA0415
RefSeq NM_014855.1
Length of RefSeq (bp) 2890
Chromosome 7p22.2
Reference DDBJ accession
UniGene Hs.558440

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe46G02 pKA1U5 GTCCGAGGTTCGTGCGCGTCTGGTGGCGGCGGCGTGATGTTCTCGGCAGGAGCGGAGAGT
ARe98G09 pKA1U5 TGGCGGTCCCGGAAGTTGACCGGGGTGCGGAGCTCCTGGGCTGCAGCTCCTGGAGTTTCC
RBdS051D20 pGCAP10 GGCGGTCCCGGAAGTTGACCGGGGTGCGGAGCTCCTGGGCTGCAGCTCCTGGAGTTTCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl