Prev. |  KEGG KO K19025 > 

RIKEN DNA Bank Human Resource - AP5Z1

Gene ID NCBI Gene 9907 |  KEGG hsa:9907
Gene Symbol AP5Z1
Protein Name adaptor related protein complex 5 subunit zeta 1
Synonyms KIAA0415|SPG48|zeta
Ortholog resource in our bank

  AP5Z1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020594 IRAK051I02 pCMV-SPORT6 BC037399 NM_014855 Partial/var
HGY088167 IRAL020G23 pOTB7 BC008841 NM_014855 Partial
HGY092230 IRAL030J14 pOTB7 BC014240 NM_014855 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058546 ARe46G02 pKA1U5 NM_014855.1  
GTCCGAGGTTCGTGCGCGTCTGGTGGCGGCGGCGTGATGTTCTCGGCAGGAGCGGAGAGT
HKR079353 ARe98G09 pKA1U5 NM_014855.1  
TGGCGGTCCCGGAAGTTGACCGGGGTGCGGAGCTCCTGGGCTGCAGCTCCTGGAGTTTCC
HKR420492 RBdS051D20 pGCAP10 NM_014855.1  
GGCGGTCCCGGAAGTTGACCGGGGTGCGGAGCTCCTGGGCTGCAGCTCCTGGAGTTTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl