Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05452

HP ID(1) HP05452
Gene ID(2) 11078
Gene Symbol finder TRIOBP
Protein Name TRIO and F-actin binding protein
RefSeq NM_007032.5
Length of RefSeq (bp) 4253
Chromosome 22q13.1
Reference DDBJ accession
UniGene Hs.533030

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe45D10 pKA1U5 GGGGCGGCCGCAGAGGGGCGGCGGCGGCGGCGCCCCTTTAAAATTNCCGCGCCNCGGAGC
ARiS085P02 pGCAP10 GGGGGCAGCGTCGGGGAAAGGAAGGGCCGGAGGCGCGGCGGCGGGCGGCCGAGAGGGGCG
ARiS191E17 pGCAP10 GGGAAGGGCCGGAGGCGCGGCGGCGGGCGGCCGANAGGGGCGGCGGNNGCGNNNNNANNN
RBb64C08 pGCAP1 GGAGGAGGAGCTGTCGCGGGCAGCCGCCTCACAGCGATGGCGGCCGAGCAGGGCCGGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl