Prev. | 

RIKEN DNA Bank Human Resource - TRIOBP

Gene ID NCBI Gene 11078 |  KEGG hsa:11078
Gene Symbol TRIOBP
Protein Name TRIO and F-actin binding protein
Synonyms DFNB28|HRIHFB2122|TAP68|TARA|dJ37E16.4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081337 IRAL003F17 pOTB7 BC003618 NM_138632 Partial
HGY085490 IRAL013M02 pOTB7 BC004303 NM_138632 Partial
HGY089602 IRAL024A02 pOTB7 BC013278 NM_138632 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058082 ARe45D10 pKA1U5 NM_007032.5  
GGGGCGGCCGCAGAGGGGCGGCGGCGGCGGCGCCCCTTTAAAATTNCCGCGCCNCGGAGC
HKR234362 ARiS085P02 pGCAP10 NM_007032.5  
GGGGGCAGCGTCGGGGAAAGGAAGGGCCGGAGGCGCGGCGGCGGGCGGCCGAGAGGGGCG
HKR276513 ARiS191E17 pGCAP10 NM_007032.5  
GGGAAGGGCCGGAGGCGCGGCGGCGGGCGGCCGANAGGGGCGGCGGNNGCGNNNNNANNN
HKR345656 RBb64C08 pGCAP1 NM_007032.5  
GGAGGAGGAGCTGTCGCGGGCAGCCGCCTCACAGCGATGGCGGCCGAGCAGGGCCGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl