Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05443

HP ID(1) HP05443
Gene ID(2) 665
Gene Symbol finder BNIP3L
Protein Name BCL2/adenovirus E1B 19kDa interacting protein 3-like
RefSeq NM_004331.2
Length of RefSeq (bp) 3505
Chromosome 8p21
Reference DDBJ accession
UniGene Hs.131226

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe44B09 pKA1U5 GGGAGACGGTCCTGCTGCTGCCGCAGTCCTGCCAGCTGTCCGACAATGTCGTCCCACCTA
ARe81A12 pKA1U5 TGAATCAGGACAGAGTAGTTCCAGAGGCAGTTCTCACTGTGACAGCCCTTCGCCACAAGA
ARe84D10 pKA1U5 GACTCGGCTTGTTGTGTTGCTGCCTGAGTGCCGGAGACGGTCCTGCTGCTGCCGCAGTCC
ARf06F01 pKA1U5 GGGTCCTGCTGCTGCCGCAGTCCTGCCAGCTGTCCGACGATGTCGTCCCACCTAGTCGAG
ARiS023H02 pGCAP10 GAAAAGGGGGCGGCGGACTCGGCTTGTTGTGTTGCTGCCTGANTGCCGGANACGGTCCTG
ARiS055E15 pGCAP10 GGTTGTGTTGCTGCCTGAGTGCCGGAGACGGTCCTGCTGCTGCCGCAGTCCTGCCAGCTG
ARiS087J16 pGCAP10 GTCGGCTTGTTGTGTTGCTGCCTGAGTGCCGGAGACGGTCCTGCTGCTGCCGCAGTCCTG
ARiS191L08 pGCAP10 GGCAGAAAAGGGGGCGGCGGACTCGGCTTGTTGTGTTGCTGCCTGAGTGCCGGAGACGGT
RBd02F03 pGCAP10 GGGGCGGCGGACTCGGCTTGTTGTGTTGCTGCCTGAGTGCCGGAGACGGTCCTGCTGCTG
RBd85D04 pGCAP10 GGGAGACGGTCCTGCTGCTGCCGCAGTCCTGCCAGCTGTCCGACGATGTCGTCCCACCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl