Prev. |  KEGG KO K15465 > 

RIKEN DNA Bank Human Resource - BNIP3L

Gene ID NCBI Gene 665 |  KEGG hsa:665
Gene Symbol BNIP3L
Protein Name BCL2 interacting protein 3 like
Synonyms BNIP3a|NIX
Ortholog resources KEGG ortholog (KEGG orthology K15465) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001806 IRAK004I14 pCMV-SPORT6 BC001559 NM_004331 Full
HGY088543 IRAL021F23 pDNR-LIB BC009603 NM_004331 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057633 ARe44B09 pKA1U5 NM_004331.2  
GGGAGACGGTCCTGCTGCTGCCGCAGTCCTGCCAGCTGTCCGACAATGTCGTCCCACCTA
HKR072412 ARe81A12 pKA1U5 NM_004331.2  
TGAATCAGGACAGAGTAGTTCCAGAGGCAGTTCTCACTGTGACAGCCCTTCGCCACAAGA
HKR073682 ARe84D10 pKA1U5 NM_004331.2  
GACTCGGCTTGTTGTGTTGCTGCCTGAGTGCCGGAGACGGTCCTGCTGCTGCCGCAGTCC
HKR082521 ARf06F01 pKA1U5 NM_004331.2  
GGGTCCTGCTGCTGCCGCAGTCCTGCCAGCTGTCCGACGATGTCGTCCCACCTAGTCGAG
HKR209370 ARiS023H02 pGCAP10 NM_004331.2  
GAAAAGGGGGCGGCGGACTCGGCTTGTTGTGTTGCTGCCTGANTGCCGGANACGGTCCTG
HKR222111 ARiS055E15 pGCAP10 NM_004331.2  
GGTTGTGTTGCTGCCTGAGTGCCGGAGACGGTCCTGCTGCTGCCGCAGTCCTGCCAGCTG
HKR235032 ARiS087J16 pGCAP10 NM_004331.2  
GTCGGCTTGTTGTGTTGCTGCCTGAGTGCCGGAGACGGTCCTGCTGCTGCCGCAGTCCTG
HKR276672 ARiS191L08 pGCAP10 NM_004331.2  
GGCAGAAAAGGGGGCGGCGGACTCGGCTTGTTGTGTTGCTGCCTGAGTGCCGGAGACGGT
HKR360923 RBd02F03 pGCAP10 NM_004331.2  
GGGGCGGCGGACTCGGCTTGTTGTGTTGCTGCCTGAGTGCCGGAGACGGTCCTGCTGCTG
HKR394076 RBd85D04 pGCAP10 NM_004331.2  
GGGAGACGGTCCTGCTGCTGCCGCAGTCCTGCCAGCTGTCCGACGATGTCGTCCCACCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl