Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05441

HP ID(1) HP05441
Gene ID(2) 6944
Gene Symbol finder VPS72
Protein Name vacuolar protein sorting 72 (S. cerevisiae)
RefSeq NM_005997.1
Length of RefSeq (bp) 1324
Chromosome 1q21
Reference DDBJ accession
UniGene Hs.2430

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe43H06 pKA1U5 GCTCCCAAAACCGAGCTGGTGAGGGGCTGCAGGCGTTTNGCGCAGTCTCGGTAGGCGGTA
ARiS045H02 pGCAP10 GCCCAAAACCGAGCTGGTGAGGGGCTGCAGGTGGCGGCGCAGTCTCGGTAGGCGGTATGA
RBd59G12 pGCAP10 GAGTGATGTCGAGCGTCGAGCTCCCAAAACCGAGCTGGTGAGGGGCTGCAGGTGGCGGCG
RBdS104C01 pGCAP10 GTCCCAAAACCGAGCTGGTGAGGGGCTGCAGGTGGCGGCGCAGTCTCGGTAGGCGGTATG
RBdS132C19 pGCAP10 GAGTCTCGGTAGGCGGTATGAGTTTGGCTGGGGGCCGGGCACCCCGGAAGACCGCTGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl