Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05439

HP ID(1) HP05439
Gene ID(2) 221749
Gene Symbol finder C6orf145
Protein Name chromosome 6 open reading frame 145
RefSeq NM_183373.3
Length of RefSeq (bp) 2211
Chromosome 6p25.2
Reference DDBJ accession
UniGene Hs.484500

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe43D08 pKA1U5 GACTCGCCGCCGCGCCGCCCCGCTGCCCCGAACGCGNGCCATACGCAGCCTCCTTGGAGT
ARiS013L03 pGCAP10 GACTCNNNCCGGCTCCCGGCTCCGGGGGTTCTCGTGGCCGCGGCAGCGCGGTCTCTGCGG
ARiS023A06 pGCAP10 GGGGGGTTCTCGTGGCCGCGGCAGCGCGGTCTCTGCGGAGGCGGCGGGGGCGCGGCCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl